- SUBJECT: DNA fingerprinting for high school students
- DATE: 4/97
-
-
- Hey labbers,
-
- I'm interested in demonstrating human DNA fingerprinting to area high
school
- students. I've looked a bit for the best commercial kit but haven't
found
- exactly what I want. I want to do real (not simulated) fingerprinting,
PCR
- based, using a saline wash to get cheek cells for the source of DNA.
I'd
- like to detect bands on a gel with ethidium bromide or other dye rather
than
- radioactivity or fluorescence. I'd like to amplify a locus or loci
which
- have several different alleles (rather than just two) in order to positively
- identify the "suspect" among a group of students. Does anyone
know of or
- have experience with a kit which has these chararcteristics?
-
- Thanks in advance,
- Dan
- ********************************
- Dr. Dan Murray
- Assistant Professor of Biology
- University of Texas-Pan American
- 1201 W. University Dr.
- Edinburg, TX 78539-2999
- phone: (210) 384-5098
- fax: (210) 381-3657
- email: dmurray@panam.edu
-
-
- Dan,
- We just published an article that tells you how to get DNA fingerprints
for
- two loci (D1S80 and ApoC2) in humans. We use a single hair instead
of cheek
- cells but I guess you could figure out the conversion if you want to
stick
- with cheek cells. We have just finished doing it again this semester
and we
- got 24 out of 26 students to get good bands. It takes two lab sessions
to
- do the PCR and then run the gel (we use EtBr and agarose gels). While
the
- gel is running, we have them practice calculating molecular weights
so they
- can determine their genotypes. This is not a kit, but tells you how
to
- build your own. It is much cheaper than the Carolina Biological kit.
-
- The reference is:
- Campbell, A. M., Williamson, J. H., Padula, D., and Sundby, S. Use
PCR and
- a Single Hair to Produce a "DNA Fingerprint". American Biology
Teacher.
- (1997) 59 (3): 172 - 178.
-
- (There is a companion paper in the same issue that talks about calculating
- molecular weights.)
-
- I hope this helps.
-
- A. Malcolm Campbell
- Biology Department
- Davidson College
- P. O. Box 1719
- Davidson, NC 28036
- phone: (704) 892-2692
- fax: (704) 892-2512
- email: macampbell@davidson.edu
- www: http://www.davidson.edu/academic/biology/biology.html
-
-
- Dan,
-
-
- The protocols for such a PCR based DNA fingerprinting can be found
in the
- ABLE proceedings, Proceedings of the 15th workshop held at Toronto,
the
- first chapter is by
- Mark Bloom, Human DNA fingerprinting by PCR. His protocol uses cheek
cells
- and primers to a highly variable locus, D1S80. Bloom mentions that
there
- are 29 different alleles of this locus and about 90% of the population
is
- heterozygous at this locus. If you use an agarose gel to look at the
PCR
- products, you will not be able to resolve all the alleles, but still
you
- will see a number of alleles.
-
- I have used his protocol successfully for classes of 200 college sophomores.
-
- I understand that Carolina Biological sells a PCR kit based on his
- protocol. I have not tried their kits.
-
- Hope this helps,
-
- Sue Karcher
-
- Dept. of Biological Sciences
- Purdue University
- West Lafayette, IN 47907
-
- suek@bilbo.bio.purdue.edu
-
-
- We have a biotech equipment loan program for local high school teachers.
- Any qualified teacher can request equipment, supplies, and reagents
for any
- of the 7 labs we have designed. One of the most popular of thos e labs
is
- DNA fingerprinting using cheek cell DNA. We routinely use two sets
on
- primers, one a random primer and the other is for a region in the TPA
gene.
- The first gives us a unique fingerprint for each student, and the second
- gives us data that can be entered into the Student Allele Database
- maintaiend at Cold Spring Harbor Laboratory. The database can be accessed
- through the DNA Learning Center at http://darwin.cshl.org.
-
-
- Jim Bader
- Department of Biology
- Case Western Reserve University
- Cleveland, Ohio 44106-7080
- jxb14@po.cwru.edu
-
-
- Biolabbers,
-
- Does anyone know if the primers for the D1S80 or ApoC2 loci are available
- already packaged or must I order them synthesized?
-
- Earl Fleck
- Department of Biology
- Whitman College
-
-
- Earl,
- We buy the primers from commercial sources; there are many to choose
from.
- We have just switched to a company called "Only DNA" that
has great prices
- and a 48 hour turnaround time.
- (800) 359-5794
-
- APOC2 facts (results not as good as D1S80 but does not require hotstart
PCR):
- * 80% of American population is heterozygous
- * 11 alleles have been published
- * the repeated sequence is two nucleotides long
- * the VNTR occurs within an intron
- * 30 dinucleotide repeats have been observed in the largest allele
- * Primers:
- #1 5' CATAGCGAGACTCCATCTCC 3'
- #2 5' GGGAGAGGGCAAAGATCGAT 3'
- ----------------------------------------------------------------------------
- -------------------------------
-
- D1S80 facts (gives better results than APOC2 but needs hotstart PCR):
- * >80% of all populations tested are heterozygous
- * 28 alleles have been published
- * repeat unit is 16 nucleotides long
- * D1S80 PCR product with zero repeat units is 142 base pairs long,
so every
- repeat unit will add
- 16 base pairs to the VNTR.
- * PCR products range from 430 to 814 base pairs long
- * 41 repeated units have been observed in the largest allele
- * Primers:
- #1 5' GAAACTGGCCTCCAAACACTGCCCGCCG 3'
- #2 5' GTCTTGTTGGAGATGCACGTGCCCCTTGC 3'
-
- I hope this helps.
-
- A. Malcolm Campbell
- Biology Department
- Davidson College
- P. O. Box 1719
- Davidson, NC 28036
- phone: (704) 892-2692
- fax: (704) 892-2512
- email: macampbell@davidson.edu
- www: http://www.davidson.edu/academic/biology/biology.html
-
-
- Hi,
-
- I 'd recommend contacting Judi Heitz at Stratagene.
-
- judi_heitz@stratagene.com
-
- She directs the
- education division and has been very active in training teachers from
- the San Diego area in biotechnology and general science outreach.
- She conducted the cheek cell PCR protocol for us in a work shop and
- it may be she has a kit or can otherwise assemble the necessary
- materials at a very competitive price
-
- Just so happens we just got back from a high school field trip to the
- Stratagene facility.
-
- Howard Kellogg
- From: "Howard Kellogg" <hkellogg@lpc.satcom.net>
-