SUBJECT: DNA fingerprinting for high school students
DATE: 4/97
 
 
Hey labbers,
 
I'm interested in demonstrating human DNA fingerprinting to area high school
students. I've looked a bit for the best commercial kit but haven't found
exactly what I want. I want to do real (not simulated) fingerprinting, PCR
based, using a saline wash to get cheek cells for the source of DNA. I'd
like to detect bands on a gel with ethidium bromide or other dye rather than
radioactivity or fluorescence. I'd like to amplify a locus or loci which
have several different alleles (rather than just two) in order to positively
identify the "suspect" among a group of students. Does anyone know of or
have experience with a kit which has these chararcteristics?
 
Thanks in advance,
Dan
********************************
Dr. Dan Murray
Assistant Professor of Biology
University of Texas-Pan American
1201 W. University Dr.
Edinburg, TX 78539-2999
phone: (210) 384-5098
fax: (210) 381-3657
email: dmurray@panam.edu
 
 
Dan,
We just published an article that tells you how to get DNA fingerprints for
two loci (D1S80 and ApoC2) in humans. We use a single hair instead of cheek
cells but I guess you could figure out the conversion if you want to stick
with cheek cells. We have just finished doing it again this semester and we
got 24 out of 26 students to get good bands. It takes two lab sessions to
do the PCR and then run the gel (we use EtBr and agarose gels). While the
gel is running, we have them practice calculating molecular weights so they
can determine their genotypes. This is not a kit, but tells you how to
build your own. It is much cheaper than the Carolina Biological kit.
 
The reference is:
Campbell, A. M., Williamson, J. H., Padula, D., and Sundby, S. Use PCR and
a Single Hair to Produce a "DNA Fingerprint". American Biology Teacher.
(1997) 59 (3): 172 - 178.
 
(There is a companion paper in the same issue that talks about calculating
molecular weights.)
 
I hope this helps.
 
A. Malcolm Campbell
Biology Department
Davidson College
P. O. Box 1719
Davidson, NC 28036
phone: (704) 892-2692
fax: (704) 892-2512
email: macampbell@davidson.edu
www: http://www.davidson.edu/academic/biology/biology.html
 
 
Dan,
 
 
The protocols for such a PCR based DNA fingerprinting can be found in the
ABLE proceedings, Proceedings of the 15th workshop held at Toronto, the
first chapter is by
Mark Bloom, Human DNA fingerprinting by PCR. His protocol uses cheek cells
and primers to a highly variable locus, D1S80. Bloom mentions that there
are 29 different alleles of this locus and about 90% of the population is
heterozygous at this locus. If you use an agarose gel to look at the PCR
products, you will not be able to resolve all the alleles, but still you
will see a number of alleles.
 
I have used his protocol successfully for classes of 200 college sophomores.
 
I understand that Carolina Biological sells a PCR kit based on his
protocol. I have not tried their kits.
 
Hope this helps,
 
Sue Karcher
 
Dept. of Biological Sciences
Purdue University
West Lafayette, IN 47907
 
suek@bilbo.bio.purdue.edu
 
 
We have a biotech equipment loan program for local high school teachers.
Any qualified teacher can request equipment, supplies, and reagents for any
of the 7 labs we have designed. One of the most popular of thos e labs is
DNA fingerprinting using cheek cell DNA. We routinely use two sets on
primers, one a random primer and the other is for a region in the TPA gene.
The first gives us a unique fingerprint for each student, and the second
gives us data that can be entered into the Student Allele Database
maintaiend at Cold Spring Harbor Laboratory. The database can be accessed
through the DNA Learning Center at http://darwin.cshl.org.
 
 
Jim Bader
Department of Biology
Case Western Reserve University
Cleveland, Ohio 44106-7080
jxb14@po.cwru.edu
 
 
Biolabbers,
 
Does anyone know if the primers for the D1S80 or ApoC2 loci are available
already packaged or must I order them synthesized?
 
Earl Fleck
Department of Biology
Whitman College
 
 
Earl,
We buy the primers from commercial sources; there are many to choose from.
We have just switched to a company called "Only DNA" that has great prices
and a 48 hour turnaround time.
(800) 359-5794
 
APOC2 facts (results not as good as D1S80 but does not require hotstart PCR):
* 80% of American population is heterozygous
* 11 alleles have been published
* the repeated sequence is two nucleotides long
* the VNTR occurs within an intron
* 30 dinucleotide repeats have been observed in the largest allele
* Primers:
#1 5' CATAGCGAGACTCCATCTCC 3'
#2 5' GGGAGAGGGCAAAGATCGAT 3'
----------------------------------------------------------------------------
-------------------------------
 
D1S80 facts (gives better results than APOC2 but needs hotstart PCR):
* >80% of all populations tested are heterozygous
* 28 alleles have been published
* repeat unit is 16 nucleotides long
* D1S80 PCR product with zero repeat units is 142 base pairs long, so every
repeat unit will add
16 base pairs to the VNTR.
* PCR products range from 430 to 814 base pairs long
* 41 repeated units have been observed in the largest allele
* Primers:
#1 5' GAAACTGGCCTCCAAACACTGCCCGCCG 3'
#2 5' GTCTTGTTGGAGATGCACGTGCCCCTTGC 3'
 
I hope this helps.
 
A. Malcolm Campbell
Biology Department
Davidson College
P. O. Box 1719
Davidson, NC 28036
phone: (704) 892-2692
fax: (704) 892-2512
email: macampbell@davidson.edu
www: http://www.davidson.edu/academic/biology/biology.html
 
 
Hi,
 
I 'd recommend contacting Judi Heitz at Stratagene.
 
judi_heitz@stratagene.com
 
She directs the
education division and has been very active in training teachers from
the San Diego area in biotechnology and general science outreach.
She conducted the cheek cell PCR protocol for us in a work shop and
it may be she has a kit or can otherwise assemble the necessary
materials at a very competitive price
 
Just so happens we just got back from a high school field trip to the
Stratagene facility.
 
Howard Kellogg
From: "Howard Kellogg" <hkellogg@lpc.satcom.net>
 

Biolab Home Page